MOUSE :: HMDP :: Human ApoB100 Transgenics

F.         Hybrid Mouse Diversity Panel:  Human ApoB100 Transgenics

1.         Mice (B. Bennett)
2.         Pilot studies (B. Bennett)
3.         Diets (B. Bennett)
4.         Atherosclerosis, pathology (B. Bennett)
5.         Plasma polyamines from Hazen (B. Bennett)

 

1.         Mice (B. Bennett)

ApoB-100 tg mice were purchased from Taconic and bred with 11 inbred and 11 recombinant inbred strains purchased from the Jackson labs.  Progeny of these crosses were genotyped to verify ApoB100tg status using forward (GAATAACTTCCGGAGAGTTGCAAT) and reverse (CTCTTAGCCCCATTCAGCTCTGAC).

The mice were fed Purina Chow containing 4% fat until 8 weeks of age, and then transferred to an Atherogenic diet, Harland Teklad TD.88031 containing 1.25% cholesterol and 0.3% cholic acid.  After 16 weeks of diet, the mice were fasted for 16 hours, anthesized with isoflurane and blood collected via retro-orbital sinus. Plasmas were stored at –80o C until assay.

 

2.         Pilot studies (B. Bennett)

Genotyping:  A description of the genotypes has been previously described. We filtered the available 140,000 SNPs to include only those with a minor allele frequency of 10% and less then 10% missing genotypes.  The number of SNPs used was approximately 85,000. A complete list of genotypes are available at: http://mouse.cs.ucla.edu/mouseHapMap.

Plasma assays: Plasma triglycerides, total cholesterol, unesterified cholesterol, HDL cholesterol, LDL/VLDL cholesterol, glucose and free fatty acids were measured as previously described19
Atherosclerotic lesions: The hearts from 288 F1 mice embedded in OCT, and serially sectioned. Every other section was collected and every third section was stained with oil red O stain as previously described19.

Statistical analysis: All statistical analyses for the project were performed using the R language and environment for statistical computing (http://cran.r-project.org/). We used an FDR calculation to assign a p-value threshold for genetic mapping studies using the q-value package in R20.  We applied the previously described EMMA linear mixed model to account for the population structure and genetic relatedness among strains in the genome-wide association mapping1, 15.

 


3.         Diets (B. Bennett)

The mice were fed Purina Chow containing 4% fat until 8 weeks of age, and then transferred to an Atherogenic diet, Harland Teklad TD.88031 containing 1.25% cholesterol and 0.3% cholic acid.

 


4.         Atherosclerosis, pathology (B. Bennett)

The hearts from 288 F1 mice embedded in OCT, and serially sectioned. Every other section was collected and every third section was stained with oil red O stain as previously described.

Mehrabian M, Allayee H, Wong J, Shi W, Wang XP, Shaposhnik Z, Funk CD, Lusis AJ. Identification of 5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in mice. Circ Res. 2002 Jul 26;91(2):120-6. PMID: 12142344.

 


5.         Plasma polyamines from Hazen (B. Bennett)

Quantification of TMAO, TMA and creatinine in mouse plasma and urine was performed using stable isotope dilution HPLC with on line electrospray ionization tandem mass spectrometry on an API 365 triple quadrupole mass spectrometer (Applied Biosystems,Foster, CA) interfaced with a Cohesive HPLC (Franklin, MA) equipped with phenyl column (4.6 × 2505mm, 5 μm Rexchrom Phenyl; Regis, Morton Grove, IL) and the separation was performed as reported previously (Wang et al., 2011). TMAO, TMA and creatinine were monitored in positive MRM MS mode using characteristic precursor–product ion transitions: m/z 76 ® 58, m/z 60®44 and m/z 114®86, respectively. The internal standards TMAO-trimethyl-d9 (d9-TMAO),TMA-d9 (d9-TMA), and creatinine methyl-d3were added to plasma or urine samples before sample processing, and were similarly monitored in MRM mode at m/z 85 ® 68, m/z 69®49 and m/z 117®89,  respectively. Various concentrations of TMAO, TMA and creatinine standards and a fixed amount of internal standards were spiked into control plasma or urine to prepare the calibration curves for quantification of plasma or urine TMAO, TMA and creatinine.